Since I started exploring CRISPRs and Cas9, I’ve been spending a bit of time working out the mechanics of animating strands of DNA for my Cas9 complexes to edit. DNA is a common character in medical animations, and we are frequently called on to manipulate it in various ways. Winding, unwinding, partially unzipping, cutting, splicing, etc, and these activities can be a challenge to rig in animation software. There is a lot more information about rigging 3D characters out there than there is about rigging a strand of DNA (Google it and see), so there is always room for experimentation.
Lightwave3D has a somewhat unknown plug-in for making DNA (It’s in the “Additional” menu and is called, cleverly enough, “DNA”),and it’s pretty cool. You can actually plug in a DNA sequence (ACAAGATGCCATTGTCCCCCGGCCTCCT…etc) and get an accurate ball and stick model of it. Getting the model to move the way you want it to, well, that’s where the Dark Arts come in…
I took a moment from my incantations experimentation to make a render of some of the DNA models I’ve been abusing working on. I think it’s the DNA for summer wine grape soda. 🙂